2m8z

Structure of d[GGTTGGCGCGAAGCATTCGCGGGTTGG] quadruplex-duplex hybrid

spinqualitylabelsall models 2m8z Show:Asymmetric Unit Biological Assembly Drag the structure with the mouse to rotate   Export Animated Image   Print3D Structural highlights 2m8z is a 1 chain structure. Full experimental information is available from OCA. For a guided tour on the structure components use FirstGlance. Method: Solution NMR Resources: FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT Publication Abstract from PubMed Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction. Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476 From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.

Proteopedia Page Contributors and Editors (what is this?)

OCA