9yzk

Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

spinqualitylabelsall models 9yzk, resolution 5.10Å Show:Asymmetric Unit Biological Assembly Drag the structure with the mouse to rotate   Export Animated Image   Print3D Structural highlights 9yzk is a 3 chain structure with sequence from Escherichia coli. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance. Method: X-ray diffraction, Resolution 5.1Å Ligands: MG Resources: FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT Function REPE1_ECOLI Replication initiator in the monomeric form, and autogenous repressor in the dimeric form.

Proteopedia Page Contributors and Editors (what is this?)

OCA