4ihv: Difference between revisions
From Proteopedia
Jump to navigationJump to search
New page: '''Unreleased structure''' The entry 4ihv is ON HOLD Authors: Hancock, Stephen P., Cascio, Duilio, Johnson, Reid C. Description: Crystal structure of Fis bound to 27 bp sequence DNA F2... |
No edit summary |
||
| (8 intermediate revisions by the same user not shown) | |||
| Line 1: | Line 1: | ||
The | ==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)== | ||
<StructureSection load='4ihv' size='340' side='right'caption='[[4ihv]], [[Resolution|resolution]] 2.72Å' scene=''> | |||
== Structural highlights == | |||
<table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br> | |||
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.716Å</td></tr> | |||
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr> | |||
</table> | |||
<div style="background-color:#fffaf0;"> | |||
== Publication Abstract from PubMed == | |||
The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes. | |||
Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.,Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC Nucleic Acids Res. 2013 May 9. PMID:23661683<ref>PMID:23661683</ref> | |||
From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | |||
</div> | |||
<div class="pdbe-citations 4ihv" style="background-color:#fffaf0;"></div> | |||
==See Also== | |||
*[[FIS protein|FIS protein]] | |||
== References == | |||
<references/> | |||
__TOC__ | |||
</StructureSection> | |||
[[Category: Escherichia coli K-12]] | |||
[[Category: Large Structures]] | |||
[[Category: Cascio D]] | |||
[[Category: Hancock SP]] | |||
[[Category: Johnson RC]] | |||
Latest revision as of 15:23, 20 September 2023
Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)
| ||||||||||||