4ihv: Difference between revisions

Latest revision as of 15:23, 20 September 2023

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Structural highlights

4ihv is a 4 chain structure with sequence from Escherichia coli K-12. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance.
Method:	X-ray diffraction, Resolution 2.716Å
Resources:	FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT

Publication Abstract from PubMed

The width of the DNA minor groove varies with sequence and can be a major determinant of DNA shape recognition by proteins. For example, the minor groove within the center of the Fis-DNA complex narrows to about half the mean minor groove width of canonical B-form DNA to fit onto the protein surface. G/C base pairs within this segment, which is not contacted by the Fis protein, reduce binding affinities up to 2000-fold over A/T-rich sequences. We show here through multiple X-ray structures and binding properties of Fis-DNA complexes containing base analogs that the 2-amino group on guanine is the primary molecular determinant controlling minor groove widths. Molecular dynamics simulations of free-DNA targets with canonical and modified bases further demonstrate that sequence-dependent narrowing of minor groove widths is modulated almost entirely by the presence of purine 2-amino groups. We also provide evidence that protein-mediated phosphate neutralization facilitates minor groove compression and is particularly important for binding to non-optimally shaped DNA duplexes.

Control of DNA minor groove width and Fis protein binding by the purine 2-amino group.,Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC Nucleic Acids Res. 2013 May 9. PMID:23661683^[1]

From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.

References

↑ Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 May 9. PMID:23661683 doi:10.1093/nar/gkt357

Proteopedia Page Contributors and Editors (what is this?)

OCA

[1] Hancock SP, Ghane T, Cascio D, Rohs R, Di Felice R, Johnson RC. Control of DNA minor groove width and Fis protein binding by the purine 2-amino group. Nucleic Acids Res. 2013 May 9. PMID:23661683 doi:10.1093/nar/gkt357

[1]

@@ Line 1: / Line 1: @@
 ==Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)==
-<StructureSection load='4ihv' size='340' side='right' caption='[[4ihv]], [[Resolution|resolution]] 2.72&Aring;' scene=''>
+<StructureSection load='4ihv' size='340' side='right'caption='[[4ihv]], [[Resolution|resolution]] 2.72&Aring;' scene=''>
 == Structural highlights ==
-<table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [http://en.wikipedia.org/wiki/Escherichia_coli_k-12 Escherichia coli k-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4IHV FirstGlance]. <br>
+<table><tr><td colspan='2'>[[4ihv]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=4IHV OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=4IHV FirstGlance]. <br>
-</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[4ihw|4ihw]], [[4ihx|4ihx]], [[4ihy|4ihy]]</td></tr>
+</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.716&#8491;</td></tr>
-<tr id='gene'><td class="sblockLbl"><b>[[Gene|Gene:]]</b></td><td class="sblockDat">ECDH1ME8569_3147, EcDH1_0445, fis ([http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&srchmode=5&id=83333 Escherichia coli K-12])</td></tr>
+<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [https://pdbe.org/4ihv PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [https://www.ebi.ac.uk/pdbsum/4ihv PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=4ihv ProSAT]</span></td></tr>
-<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=4ihv FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=4ihv OCA], [http://www.rcsb.org/pdb/explore.do?structureId=4ihv RCSB], [http://www.ebi.ac.uk/pdbsum/4ihv PDBsum]</span></td></tr>
 </table>
-== Function ==
-[[http://www.uniprot.org/uniprot/C9QXL3_ECOD1 C9QXL3_ECOD1]] Activates ribosomal RNA transcription. Plays a direct role in upstream activation of rRNA promoters (By similarity).[HAMAP-Rule:MF_00166]
 <div style="background-color:#fffaf0;">
 == Publication Abstract from PubMed ==
@@ Line 17: / Line 15: @@
 From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
 </div>
+<div class="pdbe-citations 4ihv" style="background-color:#fffaf0;"></div>
 ==See Also==
@@ Line 24: / Line 23: @@
 __TOC__
 </StructureSection>
-[[Category: Escherichia coli k-12]]
+[[Category: Escherichia coli K-12]]
-[[Category: Cascio, D]]
+[[Category: Large Structures]]
-[[Category: Hancock, S P]]
+[[Category: Cascio D]]
-[[Category: Johnson, R C]]
+[[Category: Hancock SP]]
-[[Category: Dna bending]]
+[[Category: Johnson RC]]
-[[Category: Hth domain]]
-[[Category: Indirect recognition]]
-[[Category: Minor groove compression]]
-[[Category: Protein-dna complex]]
-[[Category: Transcription-dna complex]]

4ihv: Difference between revisions

Latest revision as of 15:23, 20 September 2023

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Structural highlights

Publication Abstract from PubMed

See Also

References

Contents

Proteopedia Page Contributors and Editors (what is this?)

Navigation menu

Page actions

Page actions

Personal tools

Navigation

Search

Tools