5dtd: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
No edit summary
OCA (talk | contribs)
No edit summary
 
(2 intermediate revisions by the same user not shown)
Line 1: Line 1:


==Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)==
==Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)==
<StructureSection load='5dtd' size='340' side='right' caption='[[5dtd]], [[Resolution|resolution]] 2.64&Aring;' scene=''>
<StructureSection load='5dtd' size='340' side='right'caption='[[5dtd]], [[Resolution|resolution]] 2.64&Aring;' scene=''>
== Structural highlights ==
== Structural highlights ==
<table><tr><td colspan='2'>[[5dtd]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DTD OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5DTD FirstGlance]. <br>
<table><tr><td colspan='2'>[[5dtd]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5DTD OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5DTD FirstGlance]. <br>
</td></tr><tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=5dtd FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5dtd OCA], [http://pdbe.org/5dtd PDBe], [http://www.rcsb.org/pdb/explore.do?structureId=5dtd RCSB], [http://www.ebi.ac.uk/pdbsum/5dtd PDBsum]</span></td></tr>
</td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.642&#8491;</td></tr>
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5dtd FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5dtd OCA], [https://pdbe.org/5dtd PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5dtd RCSB], [https://www.ebi.ac.uk/pdbsum/5dtd PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5dtd ProSAT]</span></td></tr>
</table>
</table>
== Function ==
== Function ==
[[http://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI]] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>
[https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref>  
<div style="background-color:#fffaf0;">
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
== Publication Abstract from PubMed ==
Line 17: Line 18:
</div>
</div>
<div class="pdbe-citations 5dtd" style="background-color:#fffaf0;"></div>
<div class="pdbe-citations 5dtd" style="background-color:#fffaf0;"></div>
==See Also==
*[[FIS protein|FIS protein]]
== References ==
== References ==
<references/>
<references/>
__TOC__
__TOC__
</StructureSection>
</StructureSection>
[[Category: Cascio, D]]
[[Category: Escherichia coli K-12]]
[[Category: Hancock, S P]]
[[Category: Large Structures]]
[[Category: Johnson, R C]]
[[Category: Synthetic construct]]
[[Category: Dna bending]]
[[Category: Cascio D]]
[[Category: Dna binding protein-dna complex]]
[[Category: Hancock SP]]
[[Category: Hth domain]]
[[Category: Johnson RC]]
[[Category: Indirect recognition]]
[[Category: Protein-dna complex]]

Latest revision as of 08:50, 27 September 2023

Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

5dtd, resolution 2.64Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA