2m92: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
No edit summary
OCA (talk | contribs)
No edit summary
Line 1: Line 1:
{{STRUCTURE_2m92| PDB=2m92 | SCENE= }}
==Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid==
===Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid===
<StructureSection load='2m92' size='340' side='right' caption='[[2m92]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''>
{{ABSTRACT_PUBMED_23794476}}
== Structural highlights ==
<table><tr><td colspan='2'>[[2m92]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M92 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M92 FirstGlance]. <br>
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[2m8y|2m8y]], [[2m8z|2m8z]], [[2m90|2m90]], [[2m91|2m91]], [[2m93|2m93]]</td></tr>
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m92 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m92 OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m92 RCSB], [http://www.ebi.ac.uk/pdbsum/2m92 PDBsum]</span></td></tr>
</table>
<div style="background-color:#fffaf0;">
== Publication Abstract from PubMed ==
Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction.


==About this Structure==
Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref>
[[2m92]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M92 OCA].


==Reference==
From MEDLINE&reg;/PubMed&reg;, a database of the U.S. National Library of Medicine.<br>
<ref group="xtra">PMID:023794476</ref><references group="xtra"/><references/>
</div>
[[Category: Lim, K W.]]
== References ==
[[Category: Phan, A T.]]
<references/>
__TOC__
</StructureSection>
[[Category: Lim, K W]]
[[Category: Phan, A T]]
[[Category: Dna]]
[[Category: Dna]]
[[Category: Duplex]]
[[Category: Duplex]]
[[Category: Quadruplex]]
[[Category: Quadruplex]]
[[Category: Quadruplex-duplex hybrid]]
[[Category: Quadruplex-duplex hybrid]]

Revision as of 12:04, 18 December 2014

Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA