9yzk: Difference between revisions
From Proteopedia
Jump to navigationJump to search
New page: '''Unreleased structure''' The entry 9yzk is ON HOLD Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Description: Isoreticular co-crystal 1 with symmetrical expanded d... |
m Protected "9yzk" [edit=sysop:move=sysop] |
(No difference)
| |
Revision as of 08:30, 6 November 2025
Unreleased structure
The entry 9yzk is ON HOLD
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA