9yzk: Difference between revisions

From Proteopedia
Jump to navigationJump to search
OCA (talk | contribs)
New page: '''Unreleased structure''' The entry 9yzk is ON HOLD Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Description: Isoreticular co-crystal 1 with symmetrical expanded d...
 
OCA (talk | contribs)
m Protected "9yzk" [edit=sysop:move=sysop]
(No difference)

Revision as of 08:30, 6 November 2025

Unreleased structure

The entry 9yzk is ON HOLD

Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

Proteopedia Page Contributors and Editors (what is this?)

OCA