9yzk: Difference between revisions
From Proteopedia
Jump to navigationJump to search
m Protected "9yzk" [edit=sysop:move=sysop] |
No edit summary |
||
| Line 1: | Line 1: | ||
'''Unreleased structure''' | '''Unreleased structure''' | ||
The entry 9yzk is ON HOLD | The entry 9yzk is ON HOLD until Paper Publication | ||
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. | ||
| Line 7: | Line 7: | ||
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | ||
[[Category: Unreleased Structures]] | [[Category: Unreleased Structures]] | ||
[[Category: Slaughter, C.K]] | |||
[[Category: Shields, E.T]] | |||
[[Category: Snow, C.D]] | [[Category: Snow, C.D]] | ||
[[Category: Magna, E.N]] | [[Category: Magna, E.N]] | ||
Revision as of 17:55, 4 December 2025
Unreleased structure
The entry 9yzk is ON HOLD until Paper Publication
Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.
Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA