2m90: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| Line 1: | Line 1: | ||
==Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid== | |||
=== | <StructureSection load='2m90' size='340' side='right' caption='[[2m90]], [[NMR_Ensembles_of_Models | 10 NMR models]]' scene=''> | ||
== Structural highlights == | |||
<table><tr><td colspan='2'>[[2m90]] is a 1 chain structure. Full experimental information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=2M90 OCA]. For a <b>guided tour on the structure components</b> use [http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2M90 FirstGlance]. <br> | |||
</td></tr><tr id='related'><td class="sblockLbl"><b>[[Related_structure|Related:]]</b></td><td class="sblockDat">[[2m8y|2m8y]], [[2m8z|2m8z]], [[2m91|2m91]], [[2m92|2m92]], [[2m93|2m93]]</td></tr> | |||
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[http://oca.weizmann.ac.il/oca-docs/fgij/fg.htm?mol=2m90 FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=2m90 OCA], [http://www.rcsb.org/pdb/explore.do?structureId=2m90 RCSB], [http://www.ebi.ac.uk/pdbsum/2m90 PDBsum]</span></td></tr> | |||
</table> | |||
<div style="background-color:#fffaf0;"> | |||
== Publication Abstract from PubMed == | |||
Coaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction. | |||
Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476<ref>PMID:23794476</ref> | |||
== | From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine.<br> | ||
</div> | |||
[[Category: Lim, K W | == References == | ||
[[Category: Phan, A T | <references/> | ||
__TOC__ | |||
</StructureSection> | |||
[[Category: Lim, K W]] | |||
[[Category: Phan, A T]] | |||
[[Category: Dna]] | [[Category: Dna]] | ||
[[Category: Duplex]] | [[Category: Duplex]] | ||
[[Category: Quadruplex]] | [[Category: Quadruplex]] | ||
[[Category: Quadruplex-duplex hybrid]] | [[Category: Quadruplex-duplex hybrid]] | ||
Revision as of 12:04, 18 December 2014
Structure of d[GCGCGAAGCATTCGCGGGGAGGTGGGGAAGGG] quadruplex-duplex hybrid
| ||||||||||||