2m91 | pdb_00002m91
From Proteopedia
Structure of d[GGGAAGGGCGCGAAGCATTCGCGAGGTAGG] quadruplex-duplex hybrid
| ||||||||||||
Structural highlights
Publication Abstract from PubMedCoaxial and orthogonal orientations of the helices (left and right illustration, respectively) in a quadruplex-duplex junction were realized by incorporating a duplex hairpin across the diverse geometries of a quadruplex. The modularity of the approach was validated through the simultaneous attachment of multiple duplex stems onto a G-quadruplex scaffold to generate a G-junction. Structural Basis of DNA Quadruplex-Duplex Junction Formation.,Lim KW, Phan AT Angew Chem Int Ed Engl. 2013 Jun 21. doi: 10.1002/anie.201302995. PMID:23794476[1] From MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine. References
| ||||||||||||||||||
This page was last modified 11:33, 16 February 2022.