5dtd | pdb_00005dtd

From Proteopedia
Revision as of 08:50, 27 September 2023 by OCA (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Crystal structure of Fis bound to 27bp DNA F1-8C (AAATTCGTTTGAATTTTGAGCGAATTT)

5dtd, resolution 2.64Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA