9yzk | pdb_00009yzk

From Proteopedia
Revision as of 08:30, 6 November 2025 by OCA (talk | contribs) (New page: '''Unreleased structure''' The entry 9yzk is ON HOLD Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D. Description: Isoreticular co-crystal 1 with symmetrical expanded d...)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Unreleased structure

The entry 9yzk is ON HOLD

Authors: Shields, E.T., Slaughter, C.K., Magna, E.N., Snow, C.D.

Description: Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

Proteopedia Page Contributors and Editors (what is this?)

OCA

Retrieved from "https://proteopedia.org/index.php?title=9yzk&oldid=4389525"