9yzk | pdb_00009yzk

From Proteopedia
Revision as of 07:30, 18 February 2026 by OCA (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA

9yzk, resolution 5.10Å

Drag the structure with the mouse to rotate

Proteopedia Page Contributors and Editors (what is this?)

OCA