5e3o

Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)

spinqualitylabelsall models 5e3o, resolution 2.78Å Show:Asymmetric Unit Biological Assembly Drag the structure with the mouse to rotate   Export Animated Image   Print3D Structural highlights 5e3o is a 4 chain structure with sequence from Escherichia coli K-12 and Synthetic construct. Full crystallographic information is available from OCA. For a guided tour on the structure components use FirstGlance. Method: X-ray diffraction, Resolution 2.78Å Resources: FirstGlance, OCA, PDBe, RCSB, PDBsum, ProSAT Function FIS_ECOLI Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC. See Also FIS protein

Proteopedia Page Contributors and Editors (what is this?)

OCA