5e3o: Difference between revisions
From Proteopedia
Jump to navigationJump to search
No edit summary |
No edit summary |
||
| (3 intermediate revisions by the same user not shown) | |||
| Line 1: | Line 1: | ||
==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)== | ==Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)== | ||
<StructureSection load='5e3o' size='340' side='right' caption='[[5e3o]], [[Resolution|resolution]] 2.78Å' scene=''> | <StructureSection load='5e3o' size='340' side='right'caption='[[5e3o]], [[Resolution|resolution]] 2.78Å' scene=''> | ||
== Structural highlights == | == Structural highlights == | ||
<table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [ | <table><tr><td colspan='2'>[[5e3o]] is a 4 chain structure with sequence from [https://en.wikipedia.org/wiki/Escherichia_coli_K-12 Escherichia coli K-12] and [https://en.wikipedia.org/wiki/Synthetic_construct Synthetic construct]. Full crystallographic information is available from [http://oca.weizmann.ac.il/oca-bin/ocashort?id=5E3O OCA]. For a <b>guided tour on the structure components</b> use [https://proteopedia.org/fgij/fg.htm?mol=5E3O FirstGlance]. <br> | ||
</td></tr><tr id=' | </td></tr><tr id='method'><td class="sblockLbl"><b>[[Empirical_models|Method:]]</b></td><td class="sblockDat" id="methodDat">X-ray diffraction, [[Resolution|Resolution]] 2.78Å</td></tr> | ||
<tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[ | <tr id='resources'><td class="sblockLbl"><b>Resources:</b></td><td class="sblockDat"><span class='plainlinks'>[https://proteopedia.org/fgij/fg.htm?mol=5e3o FirstGlance], [http://oca.weizmann.ac.il/oca-bin/ocaids?id=5e3o OCA], [https://pdbe.org/5e3o PDBe], [https://www.rcsb.org/pdb/explore.do?structureId=5e3o RCSB], [https://www.ebi.ac.uk/pdbsum/5e3o PDBsum], [https://prosat.h-its.org/prosat/prosatexe?pdbcode=5e3o ProSAT]</span></td></tr> | ||
</table> | </table> | ||
== Function == | == Function == | ||
[ | [https://www.uniprot.org/uniprot/FIS_ECOLI FIS_ECOLI] Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.<ref>PMID:2209559</ref> <ref>PMID:8836178</ref> | ||
==See Also== | |||
*[[FIS protein|FIS protein]] | |||
== References == | == References == | ||
<references/> | <references/> | ||
__TOC__ | __TOC__ | ||
</StructureSection> | </StructureSection> | ||
[[Category: | [[Category: Escherichia coli K-12]] | ||
[[Category: | [[Category: Large Structures]] | ||
[[Category: | [[Category: Synthetic construct]] | ||
[[Category: | [[Category: Cascio D]] | ||
[[Category: | [[Category: Hancock SP]] | ||
[[Category: | [[Category: Johnson RC]] | ||
Latest revision as of 12:27, 6 March 2024
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
| ||||||||||||
