5e3o | pdb_00005e3o
From Proteopedia
Jump to navigationJump to search
Crystal structure of Fis bound to 27bp DNA F32 (AAATTTGGAGGAATTTTCTCCAAATTT)
| ||||||||||||
Structural highlights
FunctionFIS_ECOLI Activates ribosomal RNA transcription, as well other genes. Plays a direct role in upstream activation of rRNA promoters. Binds to a recombinational enhancer sequence that is required to stimulate hin-mediated DNA inversion. Prevents initiation of DNA replication from oriC.[1] [2] See AlsoReferences
| ||||||||||||||||||
This page was last modified 12:27, 6 March 2024.